Skip to main content

Flu Singapore Atau Hand Foot Mouth Disease (HFMD)

DEFINISI

"Flu Singapore" sebenarnya adalah penyakit yang di dunia kedokteran dikenal sebagai Hand, Foot, and Mouth Disease (HFMD) atau dalam bahasa Indonesia Penyakit Tangan, Kaki, dan Mulut (PTKM).

Penyakit ini sesungguhnya sudah lama ada di dunia. Berdasar laporan yang ada, kejadian luar biasa penyakit ini sudah ada di tahun 1957 di Toronto, Kanada. Sejak itu terdapat banyak kejadian di seluruh dunia. Di Indonesia sendiri sebenarnya penyakit ini bukan penyakit baru.
Istilah “Flu Singapore” muncul karena saat itu terjadi ledakan kasus dan kematian akibat penyakit ini di Singapura. Karena gejalanya mirip flu, dan saat itu terjadi di Singapura (dan kemudian juga terjadi di Indonesia), banyak media cetak yang membuat istilah “flu Singapore”, walaupun ini bukan terminologi yang baku.

PENYEBAB

PTKM ini adalah penyakit infeksi yang disebabkan oleh virus RNA yang masuk dalam famili Picornaviridae (Pico, Spanyol = kecil ), Genus Enterovirus ( non Polio ). Genus yang lain adalah Rhinovirus, Cardiovirus, Apthovirus. Di dalam Genus enterovirus terdiri dari Coxsackie A virus, Coxsackie B virus, Echovirus dan Enterovirus.
Penyebab PTKM yang paling sering pada pasien rawat jalan adalah Coxsackie A16, sedangkan yang sering memerlukan perawatan karena keadaannya lebih berat atau ada komplikasi sampai meninggal adalah Enterovirus 71. Berbagai enterovirus dapat menyebabkan berbagai penyakit.


EPIDEMIOLOGI:

Penyakit ini sangat menular dan sering terjadi dalam musim panas. PTKM adalah penyakit yang kerap terjadi pada kelompok masyarakat yang padat dan menyerang anak-anak usia 2 minggu sampai 5 tahun ( kadang sampai 10 tahun ). Orang dewasa umumnya lebih kebal terhadap enterovirus, walau bisa juga terkena.
Penularannya melalui jalur fekal-pral (pencernaan) dan saluran pernapasan, yaitu dari droplet (butiran ludah), pilek, air liur, tinja, cairan vesikel (kelainan kulit berupa gelembung kecil berisi cairan) atau ekskreta. Penularan kontak tidak langsung melalui barang, handuk, baju, peralatan makanan, dan mainan yang terkontaminasi oleh sekresi itu. Tidak ada vektor tetapi ada pembawa (“carrier”) seperti lalat dan kecoa.
Penyakit ini memberi imunitas spesifik, namun anak dapat terkena PTKM lagi oleh virus strain Enterovirus lainnya.
Masa Inkubasi 2 – 5 hari.

GEJALA

Mula-mula demam tidak tinggi 2-3 hari, diikuti sakit leher (faringitis), tidak ada nafsu makan, pilek, gejala seperti “flu” pada umumnya yang tak mematikan. Timbul vesikel yang kemudian pecah, ada 3-10 ulkus di mulut seperti sariawan ( lidah, gusi, pipi sebelah dalam ) terasa nyeri sehingga sukar untuk menelan.
Bersamaan dengan itu timbul rash/ruam atau vesikel (lepuh kemerahan/blister yang kecil dan rata), papulovesikel yang tidak gatal ditelapak tangan dan kaki. Kadang-kadang rash/ruam (makulopapel) ada dibokong. Penyakit ini umumnya akan membaik sendiri dalam 7-10 hari, dan tidak perlu dirawat di rumah sakit.

Bila ada gejala yang cukup berat, barulah penderita perlu dirawat di rumah sakit. Gejala yang cukup berat tersebut antara lain :
- Hiperpireksia, yaitu demam tinggi dengan suhu lebih dari 39 C. - Demam tidak turun-turun - Takikardia (nadi menjadi cepat) - Takipneu, yaitu napas jadi cepat dan sesak - Malas makan, muntah, atau diare berulang dengan dehidrasi. - Letargi, lemas, dan mengantuk terus - Nyeri pada leher, lengan, dan kaki. - Kejang-kejang, atau terjadi kelumpuhan pada saraf kranial - Keringat dingin - Fotofobia (tidak tahan melihat sinar) - Ketegangan pada daerah perut - Halusinasi atau gangguan kesadaran

Komplikasi penyakit ini adalah :
- Meningitis (radang selaput otak) yang aseptik - Ensefalitis (radang otak) - Myocarditis (Coxsackie Virus Carditis) atau pericarditis - Acute Flaccid Paralysis / Lumpuh Layuh Akut (“Polio-like illness” )

Satu kelompok dengan penyakit ini adalah :

  1. Vesicular stomatitis dengan exanthem (PTKM) - Cox A 16, EV 71 (Penyakit ini)
  2. Vesicular Pharyngitis (Herpangina) - EV 70
  3. Acute Lymphonodular Pharyngitis - Cox A 10


DIAGNOSA

LABORATORIUM :
Sampel ( Spesimen ) dapat diambil dari tinja, usap rektal, cairan serebrospinal dan usap/swab ulcus di mulut/tenggorokan, vesikel di kulit spesimen atau biopsi otak.
Spesimen dibawa dengan “Hank’s Virus Transport”. Isolasi virus dengan cara biakan sel dengan suckling mouse inoculation. Setelah dilakukan “Tissue Culture”, kemudian dapat diidentifikasi strainnya dengan antisera tertentu / IPA, CT, PCR dll. Dapat dilakukan pemeriksaan antibodi untuk melihat peningkatan titer.

Diagnosa Laboratorium adalah sebagai berikut :

  1. Deteksi Virus :
    - Immuno histochemistry (in situ)
    - Imunofluoresensi antibodi (indirek)
    - Isolasi dan identifikasi virus.
    Pada sel Vero ; RD ; L20B
    Uji netralisasi terhadap intersekting pools
    Antisera (SCHMIDT pools) atau EV-71 (Nagoya) antiserum.

  2. Deteksi RNA :
    RT-PCR
    Primer : 5’ CTACTTTGGGTGTCCGTGTT 3”
    5’ GGGAACTTCGATTACCATCC 3”
    Partial DNA sekuensing (PCR Product)

  3. Serodiagnosis :
    Serokonversi paired sera dengan uji serum netralisasi terhadap virus EV-71 (BrCr, Nagoya) pada sel Vero.
    Uji ELISA sedang dikembangkan.
    Sebenarnya secara klinis sudah cukup untuk mendiagnosis PTKM, hanya kita dapat mengatahui apakah penyebabnya Coxsackie A-16 atau Enterovirus 71.


PENGOBATAN
  1. Istirahat yang cukup
  2. Pengobatan spesifik tidak ada, jadi hanya diberikan secara simptomatik saja berdasarkan keadaan klinis yang ada.
  3. Dapat diberikan :
    - Immunoglobulin IV (IGIV), pada pasien imunokompromis atau neonatus
    - Extracorporeal membrane oxygenation.
  4. Pengobatan simptomatik :
    - Antiseptik di daerah mulut
    - Analgesik misal parasetamol
    - Cairan cukup untuk dehidrasi yang disebabkan sulit minum dan karena demam
    - Pengobatan suportif lainnya ( gizi dll )

    Penyakit ini adalah “self limiting diseases”, yaitu dapat sembuh dengan sendirinya, dalam 7-10 hari, pasien perlu istirahat karena daya tahan tubuh menurun. Pasien yang dirawat adalah yang dengan gejala berat dan komplikasi tersebut diatas.


PENCEGAHAN

PENCEGAHAN DAN PENGENDALIAN PENYAKIT:

Penyakit ini sering terjadi pada masyarakat dengan sanitasi yang kurang baik. Pencegahan penyakit adalah dengan menghilangkan kekumuhan dan kepadatan lingkungan; kebersihan (Higiene dan Sanitasi) lingkungan maupun perorangan. Cara yang paling gampang dilakukan adalah misalnya membiasakan selalu cuci tangan, khususnya sehabis berdekatan dengan penderita, desinfeksi peralatan makanan, mainan, handuk yang memungkinkan terkontaminasi.

Bila perlu anak tidak bersekolah selama satu minggu setelah timbul rash sampai panas hilang. Pasien sebenarnya tak perlu diasingkan karena ekskresi virus tetap berlangsung beberapa minggu setelah gejala hilang, yang penting menjaga kebersihan perorangan.

Di Rumah sakit “Universal Precaution” harus dilaksanakan.
Penyakit ini belum dapat dicegah dengan vaksin (Imunisasi)

Comments

Popular posts from this blog

fibrosis paru / Pulmonary fibrosis

Fibrosis adalah istilah yang digunakan untuk merujuk pada jaringan parut, sehingga fibrosis paru berarti jaringan parut seluruh paru-paru. Fibrosis paru dapat disebabkan oleh berbagai kondisi termasuk proses inflamasi kronis (sarkoidosis, granulomatosis Wegener), infeksi, agen lingkungan (asbes, silika, paparan gas-gas tertentu), paparan radiasi pengion (seperti terapi radiasi untuk mengobati tumor dari dada) , kronis kondisi (lupus, rheumatoid arthritis), dan obat-obat tertentu.
Dalam kondisi yang dikenal sebagai pneumonitis hipersensitivitas, fibrosis paru-paru dapat mengembangkan reaksi kekebalan setelah meningkat terhadap debu organik atau bahan kimia terhirup kerja. Kondisi ini paling sering hasil dari debu menghirup terkontaminasi dengan produk bakteri, jamur, atau binatang.
Pada beberapa orang, peradangan paru kronis dan fibrosis berkembang tanpa penyebab yang dapat diidentifikasikan. Kebanyakan dari orang-orang ini memiliki kondisi yang disebut idiopathic pulmonary fibrosis (…

RADANG TENGGOROKAN ( PHARYNGITIS )

RADANG TENGGOROKAN ( PHARYNGITIS )apa itu penyakit radang tenggorokan ?
Radang tenggorokan yang dalam bahasa medis disebut pharyngitis, adalah suatu penyakit radang yang menyerang batang tenggorok. Penyakit yang kerap disebut radang tenggorok itu ditandai adanya penebalan atau pembengkakan dinding tenggorokan, berwarna kemerahan, ada bintik-bintik putih, disertai adanya rasa sakit menelan.
Radang tenggorok bisa disebabkan infeksi virus atau kuman, disertai daya tahan tubuh yang lemah. Pengobatan dengan antibiotika hanya efektif pada radang yang disebabkan oleh kuman.
Untuk kasus radang tenggorok yang ringan, terkadang makan makanan yang sehat seperti sayur-sayuran dengan buah-buahan yang kaya vitamin bisa menolong meredakan radang. Gejala radang tenggorokan sering merupakan pratanda penyakit flu atau pilek.
Radang Tenggorok atau Pharyngitis ada dua macam, yakni akut dan kronis:
1. Pharyngitis akut.Radang tenggorok yang masih baru, dengan gejala nyeri tenggorok dan kadang disertai demam da…

FIBIO ADENOMA MAMAE ( FAM )

Fibroadenoma mammae (FAM), umumnya menyerang para remaja dan wanita dengan usia di bawah 30 tahun. Adanya fibroadenoma atau yang biasa dikenal dengan tumor payudara membuat kaum wanita selalu cemas tentang keadaan pada dirinya. Terkadang mereka beranggapan bahwa tumor ini adalah sama dengan kanker. Yang perlu ditekankan adalah kecil kemungkinan dari fibroadenoma ini untuk menjadi kanker yang ganas. Di bawah ini saya akan membahas lebih lanjut tentang fibroadenoma mammae.
DEFINISI Fibroadenoma mammae adalah tumor jinak yang paling sering terjadi pada wanita. Tumor ini terdiri dari gabungan antara kelenjar glandula dan fibrosa. Secara histologi: intracanalicular fibroadenoma; fibroadenoma pada payudara yang secara tidak teratur dibentuk dari pemecahan antara stroma fibrosa yang mengandung serat jaringan epitel. pericanalicular fibroadenoma; fibroadenoma pada payudara yang menyerupai kelenjar atau kista yang dilingkari oleh jaringan epitel pada satu atau banyak lapisan. Tumor ini dibata…